logo

Crystal structure determination of a chimeric FabF by XRD

NUCLEAR PHYSICS AND INTERDISCIPLINARY RESEARCH

Crystal structure determination of a chimeric FabF by XRD

Ke Li
Li Li
Ye-Chun Xu
Nuclear Science and TechniquesVol.28, No.9Article number 123Published in print 01 Sep 2017Available online 05 Aug 2017
203801

Beta-ketoacyl-acyl-carrier-protein synthase II, an important enzyme in biosynthesis of bacterial fatty acid, is an attractive target in antibacterial drug design. Platensimycin (PTM), produced by Streptomyces platensis, has a strong, broad-spectrum Gram-positive antibacterial activity by selectively targeting to FabF but exhibits no inhibition to the FabF from Streptomyces platensis (spFabF). To study the self-resistance mechanism within the PTM-producing strain and provide hint for development of novel antibiotics, it is imperative to solve the structure of spFabF and elucidate the difference between spFabF and other FabFs which are not resistant to PTM. To this end, we constructed four chimeric FabFs based on the sequence of spFabF and its homologous protein after the expression of wide-type spFabF was failed. The crystal structure of one chimera, js200FabF, of 91.2% sequence identity to spFabF, was solved. A structure comparison of js200FabF with a PTM-bound FabF suggested that three loops nearby the catalytic site might play key roles in preventing the binding of PTM to spFabF. The results provide an encouraging basis for further studies on the self-resistance mechanism and structure-based design of novel antibiotics targeting FabFs.

FabFChimeraX-ray diffractionCrystal structure determination.

1. Introduction

Fatty acids are essential building blocks used in assembly of many important bacterial components such as phospholipids, lipoproteins and lipopolysaccharides. Fatty acid synthases (FAS) play crucial roles in biosynthesis of bacterial fatty acids[1-5]. While Type I FASes are found in animals, fungi, and lower eukaryotes; Type II enzymes are found in prokaryotes, plastids, and mitochondria. Both types are attractive targets for antibiotics[6]. Beta-ketoacyl-acyl-carrier-protein synthases (KAS) are important members of the FAS(II) family, including KAS I (FabB), KAS II (FabF) and KAS III (FabH). FabH catalyzes the initiation of fatty acid elongation by condensing malonyl-ACP with acetyl-CoA. FabB and FabF, which catalyze acyl-ACP reactions with malonyl-ACP, can produce long-chain acyl-ACPs[7]. FabFs catalyze unique condensation reactions that are essential steps for chain elongation in fatty acid biosynthesis, hence the importance for antibacterial drug discovery.

Platensimycin (PTM), produced by Streptomyces platensis (S. platensis), has potent, broad-spectrum Gram-positive antibacterial activity and exhibits no cross-resistance to other key antibiotic-resistant bacteria such as methicillin-resistant Staphylococcus aureus (S. aureus), vancomycin-resistant Enterococci, vancomycin-intermediate S. aureus, and linezolid- resistant and macrolide-resistant pathogens[8]. The antibacterial effect of PTM was achieved by selectively targeting to FabF/B in the synthetic pathway of fatty acids[8-10]. Recently, it was reported that FabF from the PTM-producing S. platensis resisted PTM[11], but the underlying molecular mechanism is not clear yet. In this work, aimed at providing structural interpretation for the difference between the FabF from S. platensis (spFabF) and other FabFs which are susceptible to PTM, we tried to solve the crystal structure of spFabF. A chimeric protein design strategy was applied to obtain the soluble protein of spFabF. X-ray diffraction of multiple crystals of the chimeric FabF, namely js200FabF, was performed on Beamline BL17U1 of Shanghai Synchrotron Radiation Facility (SSRF), with the resolution of 3.15 Å. The structural difference between js200FabF and the PTM-bound FabF from E. coli (ecFabF) was discussed for the resistance of spFabF to PTM.

2. Experimental section

2.1 Protein expression and purification.

The wide-type of full-length spfabF with fusion proteins including TRX, MBP and GST, and four chimeras as well, constructed on the basis of spfabF and its homologous genes Streptomyces albus J1074 fabF (safabF) (Fig. 1) were subcloned into the vector pET-28a with a TEV protease cleavage site following a six-His tag added at the N-terminus. Restriction sites BamHI and XhoI were used. The DNA sequence of the wide-type spfabF and safabF were synthesized by the company of Generay Biotech (Shanghai). The primers used for gene amplification are listed in Table 1.

Table 1.
Primers used for molecular cloning.
js50fabF primer N-J50 forward primer CGCGGATCCATGAGCCCGACCAATCGTACC
  N-J50 reverse primer CTGCCTGTGCTGCAATACGAACCGGCAGGTCCGCATAACGTTC
  C-S50 forward primer GAACGTTATGCGGACCTGCCGGTTCGTATTGCAGCACAGGCAG
  C-S50 reverse primer CCGCTCGAGTTAAACGGTACGAAATGCCAG
js100fabF primer N-J100 forward primer N-J50 forward primer
  N-J100 reverse primer CACCAATACCGCTTGCAATAACTGTTCCCAGACGTTCCGGGCT
  C-S100 forward primer AGCCCGGAACGTCTGGGAACAGTTATTGCAAGCGGTATTGGTG
  C-S100 reverse primer C-S50 reverse primer
js200fabF primer N-J200 forward primer N-J50 forward primer
  N-J200 reverse primer CTGCAATCGGCAGCGGATGAATTGCTGCTTCCGTGCCACCTGC
  C-S200 forward primer GCAGGTGGCACGGAAGCAGCAATTCATCCGCTGCCGATTGCAG
  C-S200 reverse primer C-S50 reverse primer
sj200fabF primer N-S200 forward primer CGCGGATCCATGAATGCAACCAATCGTAC
  N-S200 reverse primer CAACAACCGGCAGCGGATGAATTGCTGCTTCAGTACCACCTGC
  C-J200 forward primer GCAGGTGGTACTGAAGCAGCAATTCATCCGCTGCCGGTTGTTG
  C-J200 reverse primer CCGCTCGAGTTAAACGGTACGAAATGCCAG
Show more
Fig. 1
(Color online) The scheme of four designed chimeric FabFs. Cyan and green regions represent the sequence of saFabF and spFabF, respectively. The sequence identifies of the chimeric FabFs to sbFabF were shown in the right. Taking js50FabF as an example, the first 50 amino acids are from the N-terminal 50 residues of J1074, the last 371 amino acids are from the C-terminal 371 residues of spFabF, and the sequence identity of js50FabF to spFabF is 96.7%
pic

The recombinant plasmids were transformed into E. coli BL21 (DE3) cells[12]. Cells harboring this expression plasmid were grown in LB containing 50 μg/mL kanamycin to the mid-log phase at 37℃. Subsequently, the culture was induced by 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and incubated for 14–16 hours at 16℃. The cell pellets were harvested, re-suspended, and lysed with the buffer consisting of 20 mM Tris pH 8.0, 10% (v/v) glycerol, 500 mM NaCl, 5 mM BME (β-mercaptoethanol), and 20 mM imidazole. The lysate was centrifuged. The supernatant was loaded on a 10-ml Ni-NTA Sepharose column (GE Healthcare). The column was washed with buffer A containing 20 mM Tris pH 8.0, 10% (v/v) glycerol, 500 mM NaCl, 5 mM BME, and 80 mM imidazole, until no further protein was detected by the Bio-Rad protein-assay kit, and then eluted with buffer B containing 20 mM Tris pH 8.0, 10% (v/v) glycerol, 500 mM NaCl, 5 mM BME, and 250 mM imidazole. The eluted fraction was concentrated and further loaded on the SuperdexTM 200 20/300 GL column (GE Healthcare) which is equilibrated in a gel filtration buffer consisting of 20 mM Tris pH 8.0, 100 mM NaCl, 10% (v/v) glycerol, 1 mM DL-Dithiothreitol (DTT). The eluted protein was concentrated to 10 mg/ml for crystallization.

2.2 Protein crystallization

Screening of the initial crystallization conditions was carried out using the sparse matrix approach with a series of kits including Index, Crystal Screen, Crystal Screen 2, PEG/Ion, PEG/Ion 2, SaltRx, SaltRx 2, PEGRx, PEGRx 2 (Hampton Research), and Wiz1-4 (Emerald BioSystems). Crystallization was performed at 4℃ and 20℃ using a sitting-drop vapour- diffusion method by mixing equal volumes of the protein solution (1 μL) and reservoir solution (1 μL). Once the crystal was grown, the vapour-diffusion method in hanging drops was utilized to optimize the condition. The perfluoropolyether PFO-X175/08 (Hampton Research)[13] was used as a cryoprotectant for all of the crystals. The crystals were picked up with cryo-loops and flash-frozen in liquid nitrogen.

2.3 Data collection and processing (Table 2)
Table 2.
Data collection and refinement statistics for the crystal structure of js200FabF.
Data collection  
  Wavelength (Å) 0.97923
  Temperature (K) 100
  Resolution (Å) 50–3.15(3.26–3.15)
  Total No. of reflections 1326684
  No. of unique reflections 24808
  Redundancy 10.5
  Completeness (%) 94.4
  Mean I/σ 12.7
  Rmerge 0.174
  Space group P3221
Unit cell parameters
  a (Å) 160.27
  b (Å) 160.27
  c (Å) 95.57
  α, β, γ, (°) 90, 90, 120
Refinement
  Rwork 0.1958
  Rfree 0.2790
R.m.s.d from ideality
  Bonds (Å) 0.013
  Angles (deg) 1.476
Ramachandran plot
  Allowed regions (%) 95.1
  Disallowed regions (%) 4.9
Show more

X-ray diffraction data were collected at 100 K on Beamline BL17U1 at SSRF [14], with the wavelength of 0.97923 Å and the crystal-to-detector distance of 250 mm. A total of 360 frames were collected with 0.5°oscillation and 1 s exposure time per frame. The data were processed with the HKL-2000 software package[15]. Molecular replacement was performed with Phaser[16] using the structure of Thermus thermophilus FabF (PDB code 1J3N)[17] as a search model. The structure was refined with the Phenix code [18]. Using the Coot code [19], water molecules were fitted into to the initial Fo-Fc map.

3. Results and Discussion

3.1 Design of chimeric FabFs

The expression and purification of the wide-type spFabF with different fusion proteins in E. coli, as described in Section 2, led to the aggregates of the protein. A chimeric protein design strategy was subsequently applied. Sequence alignment suggested that saFabF might be of the highest sequence identity to spFabF (76.4%). The chimeric FabFs were thus constructed with the combination of spFabF and saFabF. In general, the N-terminal region of saFabF was used in the chimeric proteins because that its sequence was more identical than the C-terminal to spFabF. The first 200 amino acid residues of saFabF showed 81.5% sequence identity to the corresponding residues of spFabF. Four chimeras, namely js50FabF, js100FabF, js200FabF, and sj200FabF, were designed (Fig. 1). Taking js200FabF as an example, the first 200 amino residues from the N-terminal of saFabF and the last 200 residues from the C-terminal of spFabF were combined (Fig. 1). The resulted js200FabF had 91.2% sequence identity to the wide-type of spFabF.

The chimeric proteins were also expressed in E. Coli. The overexpressed proteins were purified by a Ni-NTA affinity chromatography together with a gel-filtration chromatography to obtain the homogeneous soluble proteins. The gel- filtration chromatographic experiment suggested that only js200FabF might have proteins of low molecular weight, while the other three were aggregates. A further characterization of the low molecular weight samples with the analytical size exclusion chromatography showed that a single peak eluting at about 13.49 mL, which is usually corresponding to a protein of molecular weight around 90 kDa (Fig. 2). It is thus conjectured that js200FabF was a comparatively stable dimer in solution. The SDS-PAGE showed that the proteins are quite pure (purity over 95%).

Fig. 2
Characterization of js200FabF by the analytical size-exclusion chromatography and SDS-PAGE. js200FabF was eluted with a peak at 13.49 mL of the SuperdexTM 200 20/300 GL column. In the SDS-PAGE, Lanes 0–4 represent the pellet resulted from the cell lysate, the flow-through from the NTA affinity column, the elute from the NTA affinity column with buffer A (containing 80 mM imidazole), the elute from the NTA affinity column with buffer B (containing 250 mM imidazole), and the concentrated sample used for the size-exclusion chromatography, respectively. Lane M represents molecular-weight markers labelled in kDa. Lanes 5–8 are corresponding to the fractions 5–8 from the size-exclusion chromatography.
pic
3.2 Screening of crystallization conditions for js200FabF

After the pure and dimeric js200FabF were concentrated to 10 mg/mL, a crystallization condition screening was carried out using multiple screening kits. Rod crystals of the protein were obtained under conditions containing salts (the most), or PEGs (fewer) as a precipitating agent. However, these crystals had the low-resolution diffraction properties. The crystals from the condition No. 46 of Crystal Screen 2 consisting of 0.1 M NaCl, 0.1 M BICINE pH 9.0, 20% (v/v) PEG MME 550 (Fig. 3a) and the condition No. 30 of PEGRx consisting of 0.1 M HEPES pH 7.5, 12% PEG 3350 (Fig. 3b) were in bar-shapes. The crystal with the best diffraction was obtained using a reservoir solution consisting of 0.1 M Bis-Tris pH 5.5, 25% PEG 3350, 0.2 M ammonium sulfate (Fig. 3c). The crystals grown at 4℃ often showed better diffraction quality than those grown at 20 ℃. However, the crystal growth at 4℃ took about half a year before it was ready for XRD experiment. Besides, the six-His tag at the N-terminal of js200FabF showed no apparent effects on crystallization and diffraction.

Fig. 3
(Color online) Crystals of js200FabF grown with a reservoir containing 0.1 M sodium chloride, 0.1 M bicine pH 9.0, 20% (v/v) PEG MME 550 (a); 0.1 M HEPES pH 7.5, 12% PEG 3350 (b); and 0.1 M Bis-Tris pH 5.5, 25% PEG 3350, 0.2 M ammonium sulfate (c), respectively
pic
3.3 Structure determination

Crystals of js200FabF were flash-cooled in liquid nitrogen with a cryoprotectant and examined by XRD. An example of the XRD results is shown in Fig. 4. The data processing indicated that it belonged to the cubic space group P3221, with unit-cell parameters of a =160.27 Å, b =160.27 Å, and c = 95.57 Å. The calculated Matthews coefficient (VM) was 2.32 Å3/Da with 47.01% solvent content, assuming the presence of six molecules in the asymmetric unit [20]. The structure of js200FabF was finally solved with the best resolution of 3.15 Å.

Fig. 4
A typical XRD result of the js200FabF crystal.
pic

PTM is a potent inhibitor of FabF from E. coli (ecFabF) and the crystal structures of the mutant ecFabF(C163Q and C163A) in complex with PTM are the only known structure of FabF bound with PTM [8,21]. Although the sequence identity of js200FabF to ecFabF was 39.8%, the superimposition of two structures in Fig. 5(a) revealed that the topology of js200FabF was similar to ecFabF. In addition, according to the complex structure of PTM bounded ecFabF(C163Q), the binding site for PTM in js200FabF should be located at the C-terminal region, and the sequence was completely identical to the C-terminal of spFabF (Fig. 5b). This means that js200FabF can be regarded as spFabF in studying the PTM binding to spFabF. Exploring the binding pocket of PTM in ecFabF(C163Q) and spFabF, we found that the three loops (residues 211-215, 277-281 and 407-411) adopted different conformations as compared with them in ecFabF(C163Q), resulting that the assumed binding pocket of PTM in spFabF was greatly occupied by these loop residues and the superimposed PTM had many bumping with the neighboring residues of spFabF (Figs. 5c and 5d). Therefore, the different conformations of three loops may account for the resistance of spFabF to PTM.

Fig. 5
(Color online) The superimposition of js200FabF with ecFabF. (a) The cartoon representation of js200FabF (green) and ecFabF (cyan) (PDB code 2GFW). (b) Molecular surface of js200FabF. Orange and green represent the first 200 and the last 221 residues of js200FabF, respectively. The position of PTM shown in yellow sticks was taken from the superimposed ecFabF(C163Q) in complex with PTM. (c) The binding pocket of PTM in ecFabF(C163Q). (d) The overlap of the superimposed PTM with the assumed binding pocket of PTM in js200FabF
pic

4. Conclusion

We constructed four chimeric FabFs based on spFabF from the PTM-producing S. platensis and its homologous protein in an attempt to solve the structure of spFabF and interpret its resistance to PTM which is a potent and selective inhibitor of bacterial FabFs. One of the chimeras, js200FabF, could be expressed in E. Coli and purified with a pure and stable dimer protein for crystallization. The protein crystal best diffracted was grown in the condition containing 0.1 M Bis-Tris pH 5.5, 25% PEG 3350, and 0.2 M ammonium sulfate. The solved structure shown that js200FabF has a similar topology to other FabFs such as ecFabF. As compared to the structure of ecFabF in complex with PTM, three loops nearby the catalytic site change their conformations, reduce the volume of the assumed binding pocket and thus prevent the binding of PTM to spFabF. However, in view of the low resolution of the present structure, the high flexibility of loops and the fact that js200FabF has 91.2% sequence identity to sbFabF, further efforts will be made to determine the high-resolution structure of sbFabF and to use other methodologies to study the effect of loop dynamics on the binding of PTM to FabFs.

References:
1. J.W. Campbell, J.E. Cronan.

Bacterial fatty acid biosynthesis: targets for antibacterial drug discovery

. Annu Rev Microbiol, 2001, 55: 305-332. DOI: 10.1146/annurev.micro.55.1.305
Baidu ScholarGoogle Scholar
2. Y.M. Zhang, H. Marrakchi, S.W. White, et al.

The application of computational methods to explore the diversity and structure of bacterial fatty acid synthase

. J Lipid Res, 2003, 44: 1-10. DOI: 10.1194/jlr.R200016-JLR200
Baidu ScholarGoogle Scholar
3. R.J. Heath, C.O. Rock.

Fatty acid biosynthesis as a target for novel antibacterials

. Curr Opin Investig Drugs, 2004, 5: 146-153.
Baidu ScholarGoogle Scholar
4. S. Smith, A. Witkowski, A.K. Joshi.

Structural and functional organization of the animal fatty acid synthase

. Prog Lipid Res, 2003, 42: 289-317. DOI: 10.1016/S0163-7827(02)00067-X
Baidu ScholarGoogle Scholar
5. S.W. White, J. Zheng, Y.M. Zhang.

The structural biology of type ii fatty acid biosynthesis

. Annu Rev Biochem, 2005, 74: 791-831. DOI: 10.1146/annurev.biochem.74.082803.133524
Baidu ScholarGoogle Scholar
6. C.E. Christensen, B.B. Kragelund, P.V. Wettstein-Knowles, et al.

Structure of the human β-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

. Protein Sci, 2007, 16: 261-272. DOI: 10.1110/ps.062473707
Baidu ScholarGoogle Scholar
7. X. Qiu, C.A. Janson, W.W. Smith, et al.

Refined structures of beta-ketoacyl-acyl carrier protein synthase III

. J Mol Biol, 2001, 307: 341-356. DOI: 10.1006/jmbi.2000.4457
Baidu ScholarGoogle Scholar
8. J. Wang, S.M. Soisson, K. Young, et al.

Platensimycin is a selective FabF inhibitor with potent antibiotic properties

. Nature, 2006, 441: 358-361. DOI: 10.1038/nature04784
Baidu ScholarGoogle Scholar
9. S.B. Singh, H. Jayasuriya, J.G. Ondeyka, et al.

Isolation, structure, and absolute stereochemistry of platensimycin, a broad spectrum antibiotic discovered using an antisense differential sensitivity strategy

. J Am Chem Soc, 2006, 128: 11916-11920. DOI: 10.1021/ja062232p
Baidu ScholarGoogle Scholar
10. M. Wu, S.B. Singh, J. Wang, et al.

Antidiabetic and antisteatotic effects of the selective fatty acid synthase (FAS) inhibitor platensimycin in mouse models of diabetes

. Proc Natl Acad Sci, 2011, 108: 5378-5383. DOI: 10.1073/pnas.1002588108
Baidu ScholarGoogle Scholar
11. R. Peterson, T. Huang, J. Rudolf, et al.

Mechanisms of Self-Resistance in the Platensimycin- and Platencin-Producing Streptomyces platensis MA7327 and MA7339 Strains

. Chem Biol, 2014, 21: 389-397. DOI: 10.1016/j.chembiol.2014.01.005
Baidu ScholarGoogle Scholar
12. Y.X. Chen, M.J. Li, F. Yu, et al.

Using Xe as a heavy atom for phase determination of protein trichosanthin structure

. Nucl Sci Tech, 2014, 25: 60-64. DOI: 10.13538/j.1001-8042/nst.25.030502
Baidu ScholarGoogle Scholar
13. Y. Xu, M.J. Li, H. Greenblatt, et al.

Flexibility of the flap in the active site of BACE1 as revealed by crystal structures and molecular dynamics simulations

. Acta Crystallogr D, 2012, 68: 13-25. DOI: 10.1107/S0907444911047251
Baidu ScholarGoogle Scholar
14. Q.S. Wang, F. Yu, S. Huang,, et al.

The macromolecular crystallography beamline of SSRF

. Nucl Sci Tech, 2015, 26: 010102. DOI: 10.13538/j.1001-8042/nst.26.010102
Baidu ScholarGoogle Scholar
15. Z. Otwinowski, W. Minor.

Processing of X-ray diffraction data collected in oscillation mode

. Methods Enzymol, 1997, 276: 307-326. DOI: 10.1016/S0076-6879(97)76066-X
Baidu ScholarGoogle Scholar
16. A.J. McCoy, R.W. Grosse-Kunstleve, P.D. Adams, et al.

Phaser crystallographic software

. J Appl Cryst, 2007, 40: 658-674. DOI: 10.1107/S0021889807021206
Baidu ScholarGoogle Scholar
17. B. Bagautdinov, Y. Ukita, M. Miyano, et al.

Structure of 3-oxoacyl-(acyl-carrier protein) synthase II from Thermus thermophilus HB8

. Acta Crystallogr F, 2008, 64: 358-366. DOI: 10.1107/S1744309108010336
Baidu ScholarGoogle Scholar
18. P.D. Adams, P.V. Afonine, G. Bunkoczi, et al.

PHENIX: a comprehensive Python-based system for macromolecular structure solution

. Acta Crystallogr D, 2010, 66: 213-221. DOI: 10.1107/S0907444909052925
Baidu ScholarGoogle Scholar
19. P. Emsley, K. Cowtan.

Coot: model-building tools for molecular graphics

. Acta Crystallogr D, 2004, 60: 2126-2132. DOI: 10.1107/S0907444904019158
Baidu ScholarGoogle Scholar
20. B.W. Matthews.

Solvent content of protein crystals

. J Mol Biol, 1968, 33: 491-497. DOI: 10.1016/0022-2836(68)90205-2
Baidu ScholarGoogle Scholar
21. S.B. Singh, H. Jayasuriya, K.B. Herath, et al.

Isolation, enzyme-bound structure, and activity of platensimycin A1, from Streptomyces platensis

. Bioorg Med Chem Lett, 2009, 40: 4756-4759. DOI: 10.1016/j.tetlet.2009.06.118
Baidu ScholarGoogle Scholar