logo

Enhancement of radiosensitivity of MCF-7 breast cancer cells subjected to X-ray or carbon ion irradiations

NUCLEAR CHEMISTRY, RADIOCHEMISTRY, RADIOPHARMACEUTICALS AND NUCLEAR MEDICINE

Enhancement of radiosensitivity of MCF-7 breast cancer cells subjected to X-ray or carbon ion irradiations

XIE Yi
WANG Bing
Kaoru Tanaka
LI Hong-Yan
ZHAO Qiu-Yue
ZHANG Hong
Nuclear Science and TechniquesVol.27, No.1Article number 11Published in print 20 Feb 2016Available online 27 Feb 2016
30600

The sensitivity of cancer cells to radiation therapy varies based on cell cycle phase. Here we evaluated the differences between X-ray and carbon ion irradiation with respect to cellular radiosensitivity and cancer cycle arrest in the breast cancer cell line, MCF-7. The cell survival rate, cell cycle distribution and presence of apoptosis were measured by clonogenic assay and flow cytometry. BRCA1 and p21 protein levels were analyzed by western blot, and the levels of human telomerase reverse transcriptase (hTERT) mRNA expression and telomere length were detected with real time polymerase chain reaction. The results show a significant dose-dependent effects on survival rate, apoptosis and protein levels in the carbon ion group of MCF-7 cells. Decreased proliferation was not observed at 2 Gy X-ray irradiation. There were significant differences in cellular cycle arrest, apoptosis percentages and BRCA1 and p21 protein expression between X-ray and heavy ion groups. The results indicated that increasing of BRCA1 and p21 expression, and attenuation of hTERT gene expression induced by heavy ion irradiation in MCF-7 cells might relate to mechanism of cellular radiosensitivity in G2/M arrested phase.

RadiosensitivityCellular cycle arrestBRCA1P21hTERTTelomere length

1 Introduction

For many tumour entities, radiotherapy is a potent tool to achieve local control of tumour growth and severity. However, for patients with identical diagnoses and treatment paradigms, response to radiation is often heterogeneous [1]. Therefore, intrinsic radiosensitivity of tumor cells has been considered an important factor in determining how well a tumor responds to radiotherapy [2,3].

Breast cancer is the leading type of cancer in women, accounting for 25% of all cases. In 2012, it resulted in 1.68 million cases and 522,000 deaths [4]. Breast cancer is usually treated with surgery, often followed by chemotherapy or radiation therapy, or both. Radiotherapy is given after surgery to the region of the tumor bed and regional lymph nodes, to destroy microscopic tumor cells that may have escaped surgery. Radiation can reduce the risk of recurrence by 50–66% when delivered in the correct dose and is considered essential when breast cancer is treated by removing only the lump (Lumpectomy or Wide local excision).

Ionizing radiation (IR), a potent inducer of DNA lesions, induces cell growth arrest [5]. Unrepaired or improperly repaired DNA lesions can lead to chromosomal truncations and translocations, ultimately leading to cell death. Cellular radiosensitivity is principally determined by three processes: (i) mitosis-linked cell death resulting from non- or mis-repaired DNA lesions, (ii) radiation-induced differentiation resulting in a permanent cell cycle arrest, and (iii) apoptosis [6].

Telomeres are specialized DNA-protein structures located at the ends of linear chromosomes. A critically short telomere can induce cellular senescence which plays a role in tumor suppression [7]. Telomere length stabilization is required for cellular immortalization, which is achieved in most human cancer cells through expression of human telomerase reverse transcriptase (hTERT), the catalytic subunit of telomerase [8,9]. Telomerase is the key enzyme for stabilization and elongation of telomeres, a feat accomplished by adding TTAGGG repeats at the chromosome ends. Its activity is not detectable in most human somatic cells but is found in germ, immortalized and tumor cells [10].

MCF-7 breast cancer cells are hemizygous for breast cancer 1 early onset (BRCA1) mutation and p53 null. It was reported that MCF-7 cells are sensitive to low dose irradiation [11], but are of a resistant phenotype for high dose exposure. BRCA1 is part of a large complex of proteins involved in DNA-damage recognition, repair and the maintenance of genomic stability. Lack of the BRCA1 protein in mice causes them to die early in embryogenesis as a result of a high level of genomic instability and cell proliferation arrest resulting from activation of the p53/p21 pathway [12]. p21 protein plays multiple roles not only as a cell cycle regulator in response to DNA damage, but also as a regulator of transcription, senescence, apoptosis, and DNA damage repair [13].

X-rays are typical radiation for cancer treatment. Over 50% of cancer patients benefit from a superior clinical outcome with at least one session of X-ray therapy during their treatments [14]. Heavy-ion beams are suitable for deeply seated cancer treatment, because of not only their high-dose localization around the Bragg peak, but also the high biological effect. The advantage of carbon-ion beams over X-rays is their higher linear energy transfer (LET). Compared to sparsely ionizing radiation like X-rays, high-LET particles have a higher relative biological effectiveness (RBE) because they produce an intense ionization along their track and cause severe damages to DNA which are more difficult to repair [15]. Over 20,000 cancer patients accepted heavy ion therapy until 2014.

In this work, carbon-ion beams and X-rays were used to investigate the relationship between cycle phase and radiosensitivity in MCF-7 breast cancer cells, and the possible underlying mechanisms involved.

2 Experimental

2.1 Cell culture

The MCF-7 human breast cancer cell line was obtained from the American Type Culture Collection (ATCC; Rockville, MD, USA) and was maintained at 37ºC in a humidified atmosphere with 5% CO2 in Dulbecco's Modified Eagle Medium with Ham’s Nutrient F-12 mixture (DMEM-F12; Sigma-Aldrich, St. Louis, MO, USA) containing 2 mM L-glutamine, 5% fetal calf serum (Hyclone; Logan, UT, USA), 100 U/mL streptomycin (BioReagent) and 100 μg/mL penicillin (BioReagent, Beijing, China). The experiment design is shown in Fig. 1.

Fig. 1.
The design of experiment.
pic
2.2 Irradiation

MCF-7 cells were irradiated with 290 MeV/nucleon carbon ions at room temperature on the Heavy-Ion Medical Accelerator at the National Institute of Radiological Sciences (NIRS) in Chiba, Japan. The beam energy corresponds to an average LET of 13 keV/μm. The dose rates for delivery of 1.0 and 4.0 Gy were at 0.4 and 1.5 Gy/min, respectively.

The cells were also irradiated by X-rays from a linac (Pantak-320 S, Shimadzu, Japan) operated at 200 kVp and a dose-rate of 1.8 Gy/min, using a filter of 0.5 mm aluminum + 0.5 mm copper. The dose rates were measured using an exposure rate meter (AE-1321M, Applied Engineering Inc., Tokyo, Japan). This experiment was repeated three times.

2.3 Statistical analysis

The data were expressed in the mean ±standard deviation (SD). Analysis of variance (ANOVA) was used to determine statistical significance between irradiated and control groups, with p≤0.05 being selected as statistically significant.

2.4 Clonogenic survival assay

Briefly, MCF-7 cells were trypsinized and seeded in 60 mm Petri dishes (300 cells per dish) for colony growth. After 14 days, the cells were fixed with cold methanol and stained with 1% methylene blue (Sigma-Aldrich, St. Louis, MO, USA). Colonies with greater than 50 cells were counted as survivors [16].

2.5 Cell cycle analysis

The cells were trypsinized and washed with PBS, fixed with 75% ethanol overnight. Then, they were treated with 20 μg/mL ribonuclease A (Sigma-Aldrich, St. Louis, MO, USA) and 50 μg/mL propidium iodide (PI; Sigma-Aldrich, St. Louis, MO, USA) at 37°C for 30 min. DNA content was analyzed by flow cytometry with a Coulter Epics XL (Beckman Coulter, Inc., Fullerton, CA, USA) instrument using the System II program. Cell cycle distribution and apoptosis were analyzed by ModFit LT 3.0 software (Verity Software House Inc., Topsham, ME) [17].

2.6 Western blot analysis to detect BRCA1 /p21 expression

After irradiation, MCF-7 cells were counted and then washed twice with ice-cold PBS before adding RIPA lysis buffer with phenylmethanesulfonyl fluoride, aprotinin and leupeptin (Sigma-Aldrich, St. Louis, MO, USA). Protein content was quantified by the bicinchoninic acid assay (BCA) method. Immunoblots were developed using the enhanced chemiluminescence detection system according to the manufacture’s protocol. Integrated density value was measured using Alpha View (Nature Gene Corp. Medford, NJ, U.S.A) software.

2.7 Monochrome multiplex quantitative PCR (MMQPCR) to measure telomere length
2.7.1 DNA, RNA and cDNA isolation and synthesis

Total RNA was extracted with the Trizol reagent (Life Technologies; Carlsbad, CA, USA) and purified with Qiagen RNeasy Mini kit (Qiagen, Düsseldorf, Deutschland). Genomic DNA isolation was performed using the total genome DNA isolation kit (Qiagen, Düsseldorf, Deutschland) according to the manufacturer’s instructions. cDNA was synthesized with Qiagen cDNA synthesis kit (Qiagen, Düsseldorf, Deutschland) according to the manufacturer’s instructions.

2.7.2 Monochrome multiplex quantitative PCR (MMQPCR)

Telomere length was measured by assaying for relative levels of hTERT using MMQPCR as described previously [18,19]. The sequence of the four primers used is detailed in Table 1. SYBR Premix Ex Taq reagents (TaKaRa, Ishiyama, Japan) were used for RT-PCR.

Table 1.
Primers used for PCR
Primer name Primer sequence
hTERT  
  S CGGAAGAGTGTCTGGAGCAA
  AS GGATGAAGCGGAGTCTGGA
  actin-S GGGAATTCAAAACTGGAACGGTGAAGG
  actin-AS GGAAGCTTATCAAAGTCCTCGGCCACA
Telomere length  
  Tel-S ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT
  Tel-AS TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA
  Albumin-Albu CGGCGGCGGGCGGCGCGGGCTGGGCGGAAATGCTGCACAGAATCCTTG
  Albumin-Albd GCCCGGCCCGCCGCGCCCGTCCCGCCGGAAAAGCATGGTCGCCTGTT
Show more

3. Results and Discussion

We examined the effect of radiation dose on MCF-7 cell proliferation using a clonogenic survival assay. The colony- forming units of MCF-7 cells two weeks after irradiation are shown in Fig.2. The cell clonogenic survival was at 2 Gy of the X-ray and 12C groups are about the same. 原文的语义难以理解,根据图2左端的数据作此修改。However, survival rate of the heavy ion irradiation group decreased with increasing doses. The values in clonogenic survival assay of homogeneity of variances test were greater than 0.05, and two-way ANOVA test showed that they did not have interaction each other in clonogenic survival assay activity analysis, (F= 34.61, p<0.001).

Fig. 2.
MCF-7 cells survival rate by X-ray and carbon-ion irradiation (*p<0.001, ***p<0.001vs. control group).
pic

To determine whether or not the diminished clonogenic survival was due to cell cycle arrest after irradiation, we analyzed the mitotic phase profile of treated cells. The results show that the cell number in the G0/G1 phase increased significantly (p<0.05 vs. control) with the dose in the X-ray irradiation group. The percentage was 53.1% at 12 h after 4 Gy X-ray irradiation, whereas 61.5% of cells arrested at G2/M at 72 h after 4 Gy 12C ion irradiation as shown in Fig. (3d)–(3j). The results indicate that cellular cycle was arrested at G2/M phase by 12C ion irradiation (F= 97.73, p<0.001 in G0/G1 phase; F= 1.554, p=0.094 in S phase and F= 6.31, p<0.001 in G2/M phase).

Fig. 3.
Effect of ionizing irradiation on percentage of cells distributed in each phase of the cell cycle. (a–c) Representative FACS image of radiated and control MCF-7 cancer cells from three independent samples, which showed the X-rays G0/G1 and carbon ion G2/M phase cell-cycle arrest. (d–j) Changes in the MCF-7 cellular cycle distribution and apoptosis induced by X-ray or carbon ions (*p<0.05, **p<0.01, ***p<0.001vs. control group).
pic

The percentage of cells undergoing apoptosis increased with dose in the X-ray group except for 2 Gy (p<0.05 vs. control). However, the apoptosis percentage increase with doses in the 12C ion group (Fig. 3d–3j). The homogeneity of variances test of apoptosis were greater than 0.05, and two-way ANOVA test showed that they did not have interaction each other (F= 8.98, p<0.001).

Ionizing irradiations induce DNA lesions. Carbon ion beams, of higher LET and RBE than low LET X-rays [20], can cause more serious DNA damage. Our results indicate that DNA lesions induced by X-ray [21] caused cell cycle arrest at the G0/G1 phase (p<0.05 vs. control). Their repair may help to protect breast cancer cells from apoptosis, hence the radioresistance at 2 Gy. At 72 hours after 2 Gy X-ray irradiation, cell cycle phase distribution of MCF-7 was similar to that of the control state, indicating the accomplishment of DNA damage repair-induced protection from apoptosis. On the contrary, it is hard to repair DNA damage induced by 12C ion beams, hence the dose-dependent increase in apoptosis and cell cycle arrest at G2/M phase. The results show that breast cancer cells are more susceptible to carbon ion irradiation than X-ray irradiation and confirm that the cell cycle phase is paramount in determining radiosensitivity.

The expressions of BRCA1 and p21 proteins were similar (Fig. 4). The levels of both proteins expression increase with the 12C ion irradiation dose, while they nearly reverted to those of the control at 72 h after X-ray irradiation (Fig. 4a). The values in BRCA1 and p21protein expression of homogeneity of variances test were greater than 0.05, and two-way ANOVA test showed that they did not have interaction each other (F= 35.18, p<0.001 of BRCA1 and F= 18.14, p<0.001 of p21 protein).

Fig. 4.
BRCA1 and P21 protein expression in MCF-7 cells irradiated by. (a) X-rays and (b) carbon ion beam (*p<0.05, **p<0.01, ***p<0.001vs. control group).
pic

The level of BRCA-1 and P21 were upregulated in cellular cycles G2/M arrested phase. It is possible that they participated in cell cycle checkpoint activation in response to DNA lesions and assisted in coordinating the apoptosis and death of those treated cells. In our study, G2/M cell cycle arrest [22] caused by heavy ion irradiation with the purpose of cell apoptosis and death occurred [23].无法读通。 Overexpression of BRCA1protein in G2/M arrest phase has been shown to inhibit telomerase reverse transcriptase (hTERT) expression (Fig. 5) [24], which may lead to the upregulation of p21 [25], and all of them may be involved in the regulation of telomere length, Decreased telomere length could lead to cellular apoptosis and death.

Fig. 5.
Changes in expression of hTERT mRNA induced by (a) X-rays and (b) 12C ions (*p<0.05, **p<0.01, ***p<0.001vs. control group).
pic

The expression of hTERT mRNA was downregulated in the heavy ion group (Fig. 5b), which became about 37.8% lower than that of the X-ray-treated group at 72 h after 4Gy irradiation, whereas no significant difference was found in hTERT expression levels in X-ray-treated group (Fig. 5a). The values in hTERT mRNA expression of homogeneity of variances test were greater than 0.05, and two-way ANOVA test showed that they did not have interaction each other (F= 15.57, p<0.001).

In Fig. 6, the length of telomere did not change significantly in both radiation groups (F= 0.585, p=0.905). In other words, neither type of irradiation treatment affects the telomere length.

Fig. 6.
The changes of levels of telomere length induced by (a) X-rays and (b) 12C ions.
pic

Activated telomerase promotes tumor growth by modulating the expression of growth controlling genes and enhancing cell proliferation [26]. On the other hand, inhibition of telomerase activity in tumor cells induces telomere shortening and apoptosis. Thus, it is likely that the inhibition of proliferation and increase of apoptosis percentage inducing by irradiation may be mediated via the inhibition of telomerase. The attenuation of hTERT gene expression by irradiation may be part of the mechanism by which DNA lesions inhibit proliferation and induce apoptosis in cancer cells.

Surprisingly, the overall telomere length did not decrease after irradiation. This might, however, be explained by the appearance of fusion breakage fusion cycles that would lead to rearrangements, but not necessarily result in telomeric loss. It is possible that irradiation causes destabilization of the telomeric loop and uncapping of telomeres. This then leads to fusion breakage fusion cycles without net loss of telomere sequences. On the other hand, as mitotic cells divide, telomeres get shorter. After many rounds of cell division, telomeres become critically short, which stops the cell from further division and it becomes senescent. In this case, cell cycle arrest caused by radiation, resulted in slowed cell division. Therefore, we did not detect changes in telomere length. However, more data at higher dose exposures and more time after radiation are needed to confirm or deny this model.

4. Conclusions

In general, increasing of BRCA1 and p21 expression, and the attenuation of hTERT gene expression by heavy ion irradiation in MCF-7 cells might relate to cellular radiosensitivity in G2/M arrested phase, the changes of hTERT expression and telomere length is not directly related.

Referencess
1. Peters J L, Withers R H, Thames H D.

Tumor radioresistance in clinical radiotherapy

. Int J Radiat Oncol Biol Phys, 1982, 8: 101-108. DOI: 10.1016/0360-3016(82)90392-3
Baidu ScholarGoogle Scholar
2. Deacon J, Peckham M J, Steel G G.

The radio responsiveness of human tumours and the initial slope of the cell survival curve

. Radiother Oncol, 1984, 2: 317-323. DOI: 10.1016/S0167-8140(84)80074-2
Baidu ScholarGoogle Scholar
3. Kim J H, Kim H J, Chie K E, et al.

DNMT (DNA methyltransferase) inhibitors radiosensitize human cancer cells by suppressing DNA repair activity

. Radiat Oncol, 2012, 7: 39. DOI: 10.1186/1748-717X-7-39
Baidu ScholarGoogle Scholar
4. Stewart B W. and Wild C P.

World Cancer Report 2014

. World Health Organization. 2014. Chapter 1.1.
Baidu ScholarGoogle Scholar
5. Fedrigo A C, Grivicich I, Schunemann P D, et al.

Radioresistance of human glioma spheroids and expression of HSP70, p53 and EGFr

. Radiat Oncol, 2011, 6: 156-165. DOI: 10.1186/1748-717X-6-156
Baidu ScholarGoogle Scholar
6. Dikomey E, Borgmann K, Brammer I, Kasten PU.

Molecular mechanisms of individual radiosensitivity studied in normal diploid human fibroblasts

. Toxicology, 2003, 193: 125-135. DOI: 10.1016/S0300-483X(03)00293-2
Baidu ScholarGoogle Scholar
7. Greenberg R A, Chin L, Femino A, et al.

Short dysfunctional telomeres impair tumorigenesis in the INK4a (delta2/3) cancer-prone mouse

. Cell, 1999, 97: 515-25. DOI: 10.1016/S0092-8674(00)80761-8
Baidu ScholarGoogle Scholar
8. Hiyama K, Hiyama E, Ishioka S, et al.

Telomerase activity in small-cell and non-small-cell lung cancers

. J Natl Cancer Inst, 1995, 87: 895-902. DOI: 10.1093/jnci/87.12.895
Baidu ScholarGoogle Scholar
9. Wesbuer S, Lanvers-Kaminsky C, Duran-Seuberth I, et al.

Association of telomerase activity with radio- and chemosensitivity of neuroblastomas

. Radiat Oncol, 2010, 5: 66-73. DOI: 10.1186/1748-717X-5-66
Baidu ScholarGoogle Scholar
10. Houghtaling B R, Canudas S, Smith S.

A role for sister telomere cohesion in telomere elongation by telomerase

. Cell Cycle, 2012, 11: 19-25. DOI: 10.4161/cc.11.1.18633
Baidu ScholarGoogle Scholar
11. Soto J, Sainz C, González-Lamuño D, et al.

Low doses of alpha particle irradiation modify the expression of genes regulating apoptosis in human MCF-7 breast cancer cells

. Oncol Rep, 2006, 5: 577-581. DOI: 10.3892/or.15.3.577
Baidu ScholarGoogle Scholar
12. Hakem R, de la Pompa JL, Sirard C, et al.

The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse

. Cell, 1996, 85: 1009-1023. DOI: 10.1016/S0092-8674(00)81302-1
Baidu ScholarGoogle Scholar
13. Dotto GP.

P21 (WAF1/Cip1): more than a break to the cell cycle?

Biochim Biophys Acta, 2000, 1471: M43-56. DOI: 10.1016/S0304-419X(00)00019-6
Baidu ScholarGoogle Scholar
14. Delaney G, Jacob S, Featherstone C, et al.

The role of radiotherapy in cancer treatment: estimating optimal utilization from a review of evidence-based clinical guidelines

. Cancer, 2005, 104: 1129-1137. DOI: 10.1002/cncr.21324
Baidu ScholarGoogle Scholar
15. Hada M, Georgakilas AG.

Formation of clustered DNA damage after high-LET irradiation: a review

. J Radiat Res (Tokyo), 2008, 49: 203-210. DOI: 10.1269/jrr.07123
Baidu ScholarGoogle Scholar
16. Xia J F, Wang Z Z, Liu Q F, et al.

The role of autophagy in cell survival from heavy ion irradiation in the plateau region

. Nucl Sci Tech, 2014, 25: 030303. DOI: 10.13538/j.1001-8042/nst.25.030303
Baidu ScholarGoogle Scholar
17. Xie Y, Zhang H, Wang YP, et al.

N-acetylcysteine protect lymphocytes and cytokines against heavy ion irradiation via counteracting the glutamate

. Nucl Sci Tech, 2013, 24: 030304. DOI: 10.13538/j.1001-8042/nst.2013.03.003
Baidu ScholarGoogle Scholar
18. Jin W, Kong Z, Shen Z, et al.

Regulation of the radiosensitivity of tumor cells through HIF-1α dependent intracellular redox status after fractionated radiation

. Nucl Sci Tech, 2010, 21: 294-301. DOI: 10.13538/j.1001-8042/nst.21.294-301
Baidu ScholarGoogle Scholar
19. Cawthon RM.

Telomere length measurement by a novel monochrome multiplex quantitative PCR method

. Nucleic Acids Res 2009, 37: 3-21. DOI: 10.1093/nar/gkn1027
Baidu ScholarGoogle Scholar
20. Fushimia K, Uzawaa K, Ishigamia T, et al.

Susceptible genes and molecular pathways related to heavy ion irradiation in oral squamous cell carcinoma cells

. Radiother Oncol, 2008, 89: 237-244. DOI: 10.1016/j.radonc.2008.04.015
Baidu ScholarGoogle Scholar
21. Oliveri R D, Harris V P, Boyd B J.

X-Ray sensitivity and single-strand DNA break repair in mutagen-sensitive mutants of Drosophila melanogaster

. Mutat Res/DNA Repair, 1990, 235: 25-31. DOI: 10.1016/0921-8777(90)90019-2
Baidu ScholarGoogle Scholar
22. Xu X, Weaver Z, Linke S P, et al.

Centrosome amplification and a defective G2-M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells

. Mol Cell, 1999, 3: 389-395. DOI: 10.1016/S1097-2765(00)80466-9
Baidu ScholarGoogle Scholar
23. Xie Y, Zhang H, Hao JF, et al.

Effect of p53 on lung carcinoma cells irradiated by carbon ions or X-rays

. Nucl Sci Tech, 2009, 20: 146-151. DOI: 10.13538/j.1001-8042/nst.20.146-151
Baidu ScholarGoogle Scholar
24. Li H, Lee T H, Avraham H A.

A novel tricomplex of BRCA1, Nmi, and c-Myc inhibits c-Myc-induced human telomerase reverse transcriptase gene (hTERT) promoter activity in breast cancer

. J Biol Chem, 2002, 277: 20965-20973. DOI: 10.1101/cshperspect.a01442
Baidu ScholarGoogle Scholar
25. Laia R S, Cunninghama P A, Huynh Q V, et al.

Evidence of extra-telomeric effects of hTERT and its regulation involving a feedback loop

. Exp Cell Res, 2007, 313: 322-330. DOI: 10.1016/j.yexcr.2006.10.014
Baidu ScholarGoogle Scholar
26. Smith L L, Coller H A, Roberts J M.

Telomerase modulates expression of growth controlling genes and enhances cell proliferation

. Nat Cell Biol, 2003, 5: 474-479. DOI: 10.1038/ncb985
Baidu ScholarGoogle Scholar