2.1 Cell lines and cell culture

The human fibrosarcoma cell line HT1080 and normal human lung embryonic cell line MRC-5 were kindly provided by Institute of Modern Physics, Chinese Academy of Sciences, and obtained from the American Type Culture Collection (ATCC) (Manassas, VA, USA). Both of the cell lines were cultured in Dulbecco’s modified Eagle’s medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Thermo Scientific) and cultured at 37 ℃ in a humidified 5% CO₂ incubator (Thermo Scientific). The population doubling time of MRC5 was about 24 h, and that of HT1080 was 12 h.

2.2 Heavy-ion irradiation

The cells were exposed to 160 MeV/u ¹²C⁶⁺ ion beams at a dose rate of 0.2 Gy/min derived from the Heavy-ion Research Facility in Lanzhou (HIRFL, Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou, China). The LET value is 80 at peak region and 17 at plateau region. Exponentially growing HT1080 and MRC-5 cells were seeded in 96-well microtiter plate or 24-well microtiter plate, and the culture medium was replaced 24 h later before exposed to ¹²C⁶⁺ ion beams performed through the plate bottom.

2.3 Adenovirus vector and infection

Three kinds of recombinant adenoviruses were used: PPE3-EGR1-TRAIL (Ad-ET), PXC20-Δ E1b55Kda (Ad) and PPE3-GFP(Ad-GFP). These were commercially packaged and purified by Minghong Biotech (Shanghai, China). All the adenoviruses were constructed on the basis of the oncolytic adenovirus H101 backbone. The new antitumor adenovirus was constructed and packed as described [21].

After being cultured for 24 hours, the cell medium was replaced by fresh medium without FBS. The adenovirus was added into the medium for transfection. Four hours later, the same amount of medium with 20% FBS was added for the subsequent cell culturing.

2.4 Cell growth inhibition

The CCK-8 assay (Cell Counting Kit-8, Beyotime, Jiangsu, China) was used for analyzing the cell growth by quantitatively measuring cell viability. The action principle is that WST-8 can be deoxidized by dehydrogenases of viable cells to an orange formazan. Approximately 5d3 exponentially growing cells were seeded into the 96-well microtiter plates. Cells were irradiated by ¹²C⁶⁺ ion beams to 1, 2 and 4 Gy, so as to determine the optimal dose that could cause the maximal synergistic tumor cell killing effect. After ¹²C⁶⁺ ion irradiation, cells were transfected with the Ad or Ad-ET adenovirus at a MOI (multiplicity of infection) of 10 and incubated at 37 ℃ in a humidified atmosphere containing 5% CO₂ for 48 h.

To test cell growth and viability, 20 μL of a CCK-8 reaction mixture in fresh medium was added to each well after incubation. Cells were incubated at 37 ℃ for 1 hour with gentle shaking and then absorbance was measured at 450 nm in a SpectraMax M5 multifunctional microplate reader (Molecular Devices, Sunnyvale, CA). The absorbance values in the treated groups were normalized to the values of untreated cells to calculate the survival fraction: [1-(OD cells treated/OD cells treated with PBS)] × 100. Each experiment was performed in quadruplicate and repeated at least three times.

2.5 Apoptosis assay

To analyze whether the synergistic apoptosis effect can be induced by Ad-ET treatment combined with ¹²C⁶⁺ heavy-ion irradiation, First HT1080 and MRC-5 cells were seeded into 96-well microtiter plates. After exposure to ¹²C⁶⁺ ion irradiation at a dose of 0.5 or 1 Gy, Ad or Ad-ET was immediately added into the medium for transfection.

To detect the cell apoptosis fraction, both floating and attached cells were harvested after 48 h incubation following the treatment. After being washed two times with cold PBS, the cells were resuspended in 100 μL of 1 × binding buffer (Invitrogen, Carlsbad, CA). Following the protocol provided with the Invitrogen Apoptosis Detection Kit, total cells were stained with both annexin V-fluorescein isothiocyanate (FITC) and propidium iodide, and analyzed using a FACScan flow cytometer with the CellQuest program (Becton Dickinson) as soon as possible.

2.6 Real-time PCR

After treated with Ad-ET and ¹²C⁶⁺ ion irradiation, total RNA was isolated from cells using Trizol reagent (Invitrogen). First-strand cDNA was synthesized with RNA reverse transcriptase. Quantitative real-time RT-PCR amplification was carried out by using QuantiTect SYBR green (Qiagen, Valencia, CA) as described in previous article [20]. Primers for amplifying TRAIL and GAPDH mRNA were expressed as follows:

TRAIL sense: GAGCTGAAGCAGATGCAGGAC, and TRAIL antisense: TGACGGAGTTGCCACTTGACT;

GAPDH sense: CATCAAGAAGGTGGTGAAGCAGG, and GAPDH antisense: AGCGTCAAAGGTGGAGGAGTGG.

The CT (threshold cycle) value of TRAIL was quantitated by Q-PCR in triplicate using an ABI Prism 7900 HT sequence detector (AB Applied Biosciences, CA) following the manufacturer’s protocol and was normalized over the CT of the GAPDH control.

2.7 Western blot analysis

Further detection of the TRAIL gene expression level and the relative apoptisis pathway, the TRAIL protein was quantified by western blotting. The cells were harvested and lysed in lysis buffer (Beyotime, Jiangsu, China), and analyzed using the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). Cell lysates containing 40 μg of soluble total cellular protein were separated by 12% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Roche, Basle, Switzerland). These membranes were blocked for 1 hour with a buffer containing 1% fat-free dried milk and TBST (TBS with 0.1% Tween). The membrane were washed three times with TBST, and incubated overnight with primary antibodies at 4 ℃. Primary antibodies were used against TRAIL (1:500, Cell Signaling Technology, Danvers, MA), and β-actin (1:2000 Cell Signaling Technology). After being washed with TBST three times, the membranes were incubated for 1 hour with a horseradish peroxidase-conjugated anti-mouse IgG secondary antibody (Cell Signaling Technology, 1:4000) or anti-rabbit IgG secondary antibody (Cell Signaling Technology, 1:4000). Signals were visualized by enhanced chemiluminescence (Applygen, Beijing, China) using FluorChem E (Cell Biosciences, Santa Clara, CA) according to the manufacturer’s instructions.

2.8 Statistical analysis

Data were presented as means and standard derivations. Significance levels were assessed using Student’s t-test. A P-Value of 0.05 or less between groups was considered significant.

3.1 Cell viability of the cells following combined treatment of Ad-ET and ¹²C⁶⁺ ion irradiation

To test whether the combined treatment with Ad-ET and ¹²C⁶⁺ ion irradiation could cause a synergistic cell growth inhibitory effect on HT1080 tumor and MRC-5 normal cells, the cell viability was determined by the CCK-8 assay after combination treatment in vitro. To maximize the synergistic effect of combination treatment, three doses of 1, 2 and 4 Gy were used at the MOI of 10 in both tumor and normal cells.

The viability of HT1080 decreased with increasing doses within 2 Gy, and it increased under the combined treatment. Comparing the treatment group of Ad plus ¹²C⁶⁺ ion irradiation with the control group of irradiation, the survival fraction of the combined treatment decreased by varying degrees at all the three doses (Fig. 1(a)). This is probably due to synergistic effect of combination treatment and the efficiency of Ad-ET, which could reach the highest value when receiving the 2 Gy irradiation dose. The results indicate that ¹²C⁶⁺ ion irradiation can effectively activate the cell killing capacity of the radiation-inducible adenovirus Ad-ET in tumor cells HT1080. The MRC-5 cell line was also in combination treatment on normal tissues. The results show, however, that the survival fraction did not decrease significantly (Fig. 1(b)). All these indicate that combination treatment with Ad-ET and irradiation could significantly enhance the cell growth inhibition in tumor cells and is nontoxic to normal cells.

Fig. 1.Full-screen View

(Color online) Relative cell viability of HT1080 (a) and MRC-5 (b) cells infected with Ad-ET and ¹²C⁶⁺ ion irradiation. The cell survival fraction was determined using the CCK-8 assay and normalized to PBS-treated control cells (survival fraction=100%).

3.2 Cell apoptosis enhanced by the combined treatment

For further investigation of mechanism of the cell death, an Annexin-V-FITC/PI assay was used by flow cytometry after the tumor cell line HT1080 and normal cell line MRC-5 were treated with Ad-ET plus ¹²C ion irradiation. According to the results in Sec. 3.1, the ¹²C ion irradiation dose of 2 Gy was adopted in the combined treatment for apoptosis detection. As shown in Fig. 2(a), the apoptotic fraction in the Ad-ET group and the RAD group were only 5.8 % and 5.46 %, respectively, and it increased to 20.7 % with the Ad-ET+RAD treatment. The survival fraction was much higher than that of the Ad plus RAD group, indicating that increasing apoptosis effect can be induced by ¹²C⁶⁺ ion irradiation only when combined with Ad-ET. That means ¹²C⁶⁺ ion irradiation can greatly sensitize the cells to the effect of Ad-ET by activating TRAIL-induced apoptosis in HT1080 cells. However, similar synergistic apoptosis effect was not observed in the MRC-5 cells when treated with Ad-ET+ RAD. As shown in Fig. 2(b), the degree of apoptosis just slightly increased in MRC-5 cells with the Ad-ET+RAD group. These demonstrate that the combined treatment of Ad-ET and ¹²C⁶⁺ ion irradiation could only induce a significant synergistic cell apoptosis effect specifically in tumor cells, but not in normal lung cells. This is probably due to the different sensitivity of TRAIL-induced apoptosis between tumor cells and normal cells.

Fig. 2.Full-screen View

(Color online) Cell apoptosis of HT1080 (a) and MRC5 (a) cells infected with Ad-ET and¹²C⁶⁺ ion irradiation. The proportion of apoptotic cells was determined by annexin-V-FITC/PI assay. P < 0.05, Student’s t-test.

3.3 TRAIL gene expression in HT1080 cells treated with Ad-ET+RAD

To elucidate mechanism of the synergistic apoptosis induced by Ad-ET combined with ¹²C⁶⁺ ion irradiation, we detected the level of TRAIL gene expression by real-time PCR. As shown in Fig. 3, the fold of increase in the RAD, Ad-GFP, Ad-GFP+RAD and Ad-ET groups was less than 20 when the TRAIL gene expression in PBS control group was set as 1, while in the group of Ad-ET plus ¹²C⁶⁺ ion irradiation, the TRAIL gene increased to 100. The results show that ¹²C⁶⁺ ion irradiation could enhance the pro-apoptotic TRAIL gene expression in tumor cells treated with Ad-ET. The increased cytotoxicity observed in apoptosis analysis was mostly due to the elevated TRAIL gene expression when activated by ¹²C⁶⁺ ion irradiation.

Fig. 3.Full-screen View

(Color online) TRAIL gene expression in HT1080 cells infected with Ad-ET and ¹²C⁶⁺ ion irradiation. The level of TRAIL gene expression was detected real-time PCR and normalized to PBS-treated control cells with their survival fraction set as 1. P < 0.05, Student’s t-test.

3.4 Expression of TRAIL proteins following the combined treatments of HT1080 cells

For further detection of the TRAIL protein expression following TRAIL gene activation in HT1080 cells treated with Ad-ET and ¹²C⁶⁺ ion irradiation, we detected the level of TRAIL protein by western blotting. As shown in Fig. 4, the band in Ad-ET plus ¹²C⁶⁺ ion irradiation group was much thicker than other treatment groups, showing that the expression of TRAIL protein in Ad-ET-infected HT1080 cells was dramatically enhanced following exposure to ¹²C⁶⁺ ion beams. The result indicates that the pro-apoptotic effect in Ad-ET treated tumor cells could be enhanced by ¹²C⁶⁺ ion irradiation by activating the TRAIL expression.

Fig. 4.Full-screen View

Western blot analysis of TRAIL protein expression in HT1080 cells. Actin was used as the internal control. The expression level of each band was standardized to actin, and expressed as a fold-increase with the control set as 1.