logo

Protein-mimicking nanoparticle (protmin)-based nanosensor for intracellular analysis of metal ions

NUCLEAR PHYSICS AND INTERDISCIPLINARY RESEARCH

Protein-mimicking nanoparticle (protmin)-based nanosensor for intracellular analysis of metal ions

Dan Zhu
Dong-Xia Zhao
Jia-Xuan Huang
Jiang Li
Xiao-Lei Zuo
Li-Hua Wang
Chun-Hai Fan
Nuclear Science and TechniquesVol.29, No.1Article number 5Published in print 01 Jan 2018Available online 21 Dec 2017
202000

In this study, we designed and applied protein-mimicking nanoparticles (Protmin) as an intracellular nanosensor for in vivo detection of lead ions (Pb2+). Monodispersed gold nanoparticles (AuNPs) of 13 nm in diameter were modified using poly-adenine-tailed Pb2+-specific 8-17 DNAzyme to form a spherical and functional Protmin. Substrate strands modified with a fluorophore at the 5′ end and a quencher at the 3′ end were bound to DNAzyme. Pb2+ facilitated cleavage of DNAzyme to release the fluorophore-modified short strands to generate fluorescence. We observed rapid kinetics of the Protmin nanosensor, for which the typical assay time was 10 min. Further, we demonstrated the Protmin nanosensor could readily enter living cells and respond to Pb2+ in the intracellular environment. The broad of range of Protmin designs will be useful for advancing biological and medical applications.

Protminnanosensorpoly-adeninelead ionintracellular detection

Ⅰ. INTRODUCTION

Metal ions play an important role in cellular activities and participate in a variety of physiological processes. The maintenance of proper concentrations of metal ions in cells or tissues fundamentally affects various processes, such as supporting the basic structures and functions of nucleic acids, proteins, and hormones[1-3]. Recent studies demonstrated that various diseases, such as neural disturbance, organic damage, and cancer or gene mutation, are related to abnormal levels of metal ions or the presence of toxic metal ions[4-6]. Over the past few decades, many sensors have been designed to detect metal ions in environmental samples or biological samples with a high sensitivity and selectivity[7-12]. In recent years, tracing metal ions in cells have generated concerns because of their fundamental roles in biology and health. Developing sensitive, fast, and responsive cellular sensors is very important for understanding different functions at the molecular level in cells.

Proteins are among the most important components in cells and tissues in the body and participate in various physiological processes. Proteins also have a significant clinical value in disease diagnosis and as therapeutics[13]. Therefore, developing proteins with specific functions has been widely examined. However, natural proteins regulate their catalytic activity by binding to scaffolding proteins or assembling at the membrane and do not effectively cross the membrane of cells to exert their functions. Thus, the utilization of proteins as diagnostic probes and therapeutic agents is limited because of their instability and poor transduction across cell membranes. Nanomaterials may be useful for overcoming these limitations. By combining nanomaterials with enzyme-like molecules, protein-mimicking nanoparticles (Protmins) can be developed with multiple functions and favorable stability in the biological environment. Gold nanoparticles (AuNPs) have been widely investigated nanomaterials because of their unique chemical and physical properties. The high surface-to-volume ratio, favorable chemical stability, and easy modification make AuNPs applicable for biosensing[14-17], nanophotonics[18,19], catalysis[20-22], and drug delivery[23-25]. Through assembly with DNA probes, AuNP conjugates can enter cells without the use of additional transfection agents[26], enabling the construction of protein-mimicking nanostructures with excellent biocompatibility.

In this study, we constructed and applied an AuNP-based Protmin as an intracellular nanosensor for efficient in vivo lead (Pb2+) detection. DNAzyme was employed as a recognition and sensing element in the design of Protmin. As an enzyme-like oligonucleotide, DNAzyme can efficiently recognize its specific target with excellent specificity and possesses catalytic proteinase-like activity[27,28]. DNAzyme assembled onto AuNPs efficiently recognized intracellular target metal ions, such as uranyl [29], copper, and zinc ions[30]. Salaita et al. evaluated the activity of DNAzyme on AuNPs and found that it mostly depends on the conformation and density of DNAzyme on the nano-interface, while the active sites of DNAzyme may be hidden by the adsorption between DNA and the gold surface[31]. To improve the activity of Protmin, a poly-adenine (polyA)-tailed probe was employed, which has been shown to have high activity in vitro[32-36]. The polyA tail serves as an efficient anchoring block based on its preferential binding with the AuNP surface and prevents nonspecific adsorption between the active sites of DNAzyme and gold surface, thus improving the sensitivity for Pb2+ detection. The sensitivity, selectivity, and kinetics of the Protmin-based nanosensor were investigated in vitro. The existence of intracellular Pb2+ was evaluated by fluorescence imaging, which is an effective tool for investigating subcellular structures and intracellular fluorescence[19]. By transferring this Protmin nanosensor into cells, intracellular toxic Pb2+can be detected.

Ⅱ. EXPERIMENTAL SECTION

A. Apparatus and materials

Oligonucleotides (Table 1) were synthesized and purified by TaKaRa, Inc. (Shiga, Japan). HAuCl4 ·4H2 O (99.9%), NaCl, NaH2 PO4 ·2H2 O, and NaH2 PO4 ·12H2 O were purchased from China National Pharmaceutical Group Corporation (Shanghai, China). Pb(OAc)2, 6-mercapto-1-hexanol (MCH), diethylpyrocarbonate (DEPC), trisodium citrate, ethyl acetate, and other chemicals were all obtained from Sigma-Aldrich (St. Louis, MO, USA). All solutions were prepared with ultrapure water (18.2 MΩ·cm). Transmission electron microscopy (TEM) imaging was performed using H-75000 model (Hitachi, Tokyo, Japan). UV-vis spectra were measured with a U-3900 (Hitachi). Fluorescence measurements were performed on an F-4500 (Hitachi). Cell imaging and fluorescence imaging in cells were conducted using a laser confocal microscope (Leica TCS SP5, Wetzlar, Germany)

Table 1.
Base sequences and their labeling of DNA oligonucleotide samples used in the study.
DNA Name sequence (5′-3′)
polyA10-17E AAAAAAAAAATTTTTCATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT
polyA10-17E-F AAAAAAAAAATTTTTCATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT-FAM
Active 17S Cy3- ACTCACTATrAGGAAGAGATG-BHQ-2
Inactive 17S Cy3- ACTCACTATAGGAAGAGATG-BHQ-2
Show more
B. Preparation of 13-nm AuNPs

Thirteen-nanometer AuNPs were synthesized following classical citrate reduction procedures[37]. Briefly, 3.5 mL of 1% trisodium citrate was quickly added to a boiling, rapidly stirring 0.01% aqueous HAuCl4 solution, which changed the solution color from pale yellow to burgundy red. After further boiling for 20 min, the solution was left to cool to 25°C while stirring. The prepared AuNPs were stored at 4°C until use and the size of the AuNPs were determined by TEM imaging.

C. Preparation of polyA-tailed Protmin

The prepared AuNPs were first incubated with polyA-tailed DNAzyme (polyA10-17E) in a 1:200 ratio for 16 h. Next, 1 M of phosphate-buffered saline (PBS, 1 M of NaCl, 100 mM of NaH2 PO4 /Na2 HPO4, pH 7.4) was added to the mixture 5 times repeatedly at 30-min intervals to achieve a 0.1 M phosphate concentration. The salt solution was incubated for an additional 40 h at room temperature. Next, the solution was centrifuged (13500 rpm, 20 min) and resuspended in 0.1 M PBS (0.1 M of NaCl, 10 mM of NaH2 PO4 /Na2 HPO4, pH 7.4) three times. The prepared Protmin was resuspended in the reaction buffer (20 mM tris, 100 mM NaCl, pH 7.4, prepared in DEPC-treated water) until use.

D. Calculation of 17E loading on AuNPs

The loading of 17E was determined by attaching FAM-labeled 17E (polyA10-17E-F) onto the 13-nm AuNPs. The concentration of 17E-AuNPs was determined by UV-vis spectroscopy measurements using Beer’s law (for 13 nm AuNPs, ε520 nm = 2.7 × 108 L mol-1 cm-1). FAM-labeled 17E was chemically displaced from the surface of AuNPs by MCH treatment (final concentration 10 mM in 0.3 M NaCl, 10 mM phosphate buffer solution, pH 7.4) after 18 h incubation at 37°C with shaking. The released fluorescent DNA was collected via centrifugation and measured with the F-4500. The fluorescence was converted to molar concentrations of probes by comparison to a standard curve, which was prepared using known concentrations of 17E-F under the same conditions. The loading of DNA was calculated by dividing the concentration of fluorescent 17E-F by the concentration of AuNPs. Experiments were repeated three times using fresh samples.

E. Determination of activity of Protmin nanosensor in vitro

The RNA contained substrate strand "Active 17S" was modified with Cy3 label at the 5′ end and BHQ-2 at the 3′ end. The Protmin nanosensor was fabricated as follows. First, active 17S was added to a Protmin solution to a final ratio of 2:1 17S to 17E strand. The solution was heated at 65°C for 5 min, and then cooled at 25°C for 1 h. The solution was stored at 4°C overnight to complete the reaction. Excess 17S was removed by centrifugation and the prepared Protmin nanosensor was washed with reaction buffer three times. Finally, the Protmin nanosensor was diluted to a concentration of 2 nM in the reaction buffer. A series concentration of Pb(OAc)2 stock solution was added to the Protmin nanosensor. Fluorescence spectra were collected at 540 nm excitation.

F. Pb2+ cellular uptake and imaging

Active or inactive Protmin nanosensors were prepared by hybridizing "Active 17S" or "Inactive 17S" with Protmin. HeLa cells were dispersed at a density of 1.0 × 105 cells per well in 24-well microtiter plates to a total volume of 500 μL/well. The plates were maintained at 37°C in a 5% CO2/95% air incubator for one day. After removing the original incubation medium, HeLa cells were incubated with Pb2+ at a final concentration of 200 μM for 12 h to allow sufficient metal ion uptake. The cells were washed thrice using 0.1 M PBS. Next, 600 μL of dulbecco’s modified eagle medium (DMEM) culture medium containing 2 nM active or inactive A10-17ES-AuNPs was added. After 2 h of incubation, the cells were washed using PBS thrice and fresh DMEM was added. Lysotracker Green was added to the cells for another 30 min at a final concentration of 50 nM. Fluorescence images were acquired with a confocal laser scanning microscope.

G. MTT Assay

An MTT assay was carried out to investigate the cytotoxicity of the nanosensor. HeLa cells (1.0 × 105 cells per well) were dispersed in 24-well microtiter plates to a total volume of 500 μL/well. The plates were maintained at 37°C in a 5% CO2/95% air incubator for one day. After removing the original medium, HeLa cells were incubated with unmodified AuNPs (1 nM) or nanosensor (1 nM and 3 nM) for 3, 6, 12, and 24 h. Next, the medium was replaced with another medium containing MTT (0.5 mg/mL) and cells were incubated for another 4 h incubation at 37°C. After removing the medium, 150 μL DMSO was added to the cells to dissolve the formed formazan. Absorbance at 490 nm in each well was recorded. Cell viability was expressed as the ratio of the absorbance of the cells incubated with AuNPs or the nanosensor to that of cells incubated with only culture medium.

Ⅲ. RESULTS AND DISCUSSION

A. Fabrication and working principle of the Protmin nanoprobe

Based on the polyA-tailed DNAzyme specific for Pb2+cleavage, we constructed a Protmin nanosensor for Pb2+detection in cells. As shown in Fig. 1, Protmin was first prepared by attaching the polyA-tailed DNAzyme onto the surface of AuNPs through polyA-Au binding, extending the DNAzyme block for further reactions. Protmin was then hybridized with the fluorescent 17S substrate strands to fabricate 17ES-AuNP. The substrate strands were labeled with a fluorophore at the 5′ end and quencher at the 3′ end. After attachment to the AuNPs, the fluorophore was quenched by gold and a quencher, resulting in very weak fluorescence. In the presence of Pb2+, the substrate strands were cleaved, resulting in the release of short fluorophore-labeled DNA and an increase in fluorescence.

Fig. 1.
(Color online) Schematic illustration of Pb2+imaging in living cells based on polyA-tailed protein-mimicking nanoparticles (Protmin).
pic
B. Characterization of Protmin probe

Because the 13-nm AuNP was reported to be an efficient quencher[38] and intracellular nanocarrier[26], our design was based on this intracellular nanosensor. TEM images of AuNPs (Fig. 2a) showed that the 13-nm AuNPs were successfully synthesized with good dispersion. The UV-Vis absorption spectra of AuNPs and polyA10-tailed Protmin (AuNPs functionalized with polyA10-tailed DNAzyme) shown in Fig. 2b demonstrated that the maximum optical absorption was shifted from 520 to 524 nm after polyA-tailed DNAzyme assembly on the surface of AuNPs. Because the position of the plasmon band of metal nanoparticles is closely related to the size and surrounding environment,the red shift in spectroscopy confirmed that the AuNPs were successfully functionalized with polyA10-tailed DNAzyme[39].By using a displacement-based fluorescence method established by Mirkin[40], each AuNP was estimated to carry 42 ± 2 DNAzyme, which was in accordance with our previous result[33].

Fig. 2.
(Color online) (a) TEM images of 13-nm AuNPs; (b) UV-vis spectra for unmodified AuNPs (black line) and the Protmin (red line).
pic
C. Pb2+ detection of Protmin nanosensor in vitro

We first evaluated the feasibility of using the Protmin nanosensor for Pb2+ detection in vitro (Fig. 3a). The curve a in Fig. 3a shows the fluorescence spectrum of free Cy3- and BHQ-2-labeled active 17E solution upon excitation at 540 nm. After hybridization with Protmin, fluorescence was decreased significantly because of efficient quenching by AuNPs (curve b in Fig. 3a). After adding Pb2+, the substrate strand was cleaved and the Cy3-labeled short strand was released, increasing the fluorescence of the system (curve c in Fig. 3a). These results indicate that the Protmin nanosensor functioned well in response to Pb2+ in vitro. The results of kinetics in Fig. 3b show that the Protmin nanosensor responds rapidly to Pb2+ and the fluorescence at 565 nm reached a plateau after 10-min incubation with Pb2+, which was 2-fold faster than that of a thiolated DNAzyme-based nanosensor[29]. These fast-kinetic results may be attributed to the elimination of nonspecific adsorption between gold and DNAzyme by using polyA tails. These results demonstrate the potential for rapid detection by using Protmin-based sensors.

Fig. 3.
(Color online) (a) Fluorescence spectra of Cy3- and BHQ-2 labeled "Active 17S" in solution (curve a), Protmin-based nanosensor in the absence (curve b) and presence (curve c) of 100 nM Pb2+; (b) Kinetics of the nanoprobe in the absence (black curve) and presence of 100 nM Pb2+. The excitation wavelength was 540 nm.
pic
D. Sensitivity of selectivity of Protmin nanosensor in vitro

To test the sensitivity of the nanosensor, different concentrations of Pb2+ (0–2 μM) were added and emission fluorescence were recorded. The fluorescence signal at 565 nm increased as the concentration of Pb2+ increased (Fig. 4a). Good linearity was obtained from 5–30 nM. The linear equation was Fluorescence (F565 nm) = 0.6732 CPb2+ (nM) + 21.66, with a correlation coefficient of 0.9143. The detection limit of Pb2+ was calculated to be 5.33 nM. This assay is more sensitive or comparable to other intracellular Pb2+ assays[41-43] because of the high activity of polyA-mediated DNAzyme on AuNPs[33].To evaluate the selectivity of the nanoprobe for sensing Pb2+, other biologically relevant metal ions, including Mg2+, Co2+, Fe3+, Cu2+, Zn2+, K+, and Ca2+, were tested. As shown in Fig. 4b, the Protmin nanosensor exhibited 2- to 3-fold higher fluorescence signals for Pb2+ than for other metal ions at higher concentrations. Thus, the nanosensor is suitable for evaluation in complex biological systems.

Fig. 4.
(Color online) (a) Fluorescence intensity at 565 nm in the presence of various concentrations of Pb2+ (0, 5, 10, 15, 20, 30, 50, 100, 200, 500, 1000, and 2000 nM). Inset: Calibration curve for the fluorescence intensity versus corresponding Pb2+ concentration. (b) Specificity of the nanoprobe for Pb2+ compared to other metal ions (Mg2+, Co2+, Fe3+, Cu2+, Zn2+, K+, Ca2+). The concentration of other metal ions was 50 μM and concentration of Pb2+ was 100 nM. The excitation wavelength was 540 nm.
pic
E. Intracellular sensing of Pb2+ using Protmin nanosensor

The application of the Protmin-based nanosensor for intracellular Pb2+ was tested. The cellular uptake and fluorescence response of the sensor were evaluated using HeLa cells as a model. To evaluate the cytotoxicity of the nanosensor, an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay in HeLa cells was performed. The results indicated that the AuNPs (1 nM) and nanosensor (1 and 3 nM) showed low cytotoxicity or side effects in HeLa cells (Fig. 5). Therefore, the nanosensor is a reliable probe for detection in biological samples.

Fig. 5.
MTT assay of HeLa cells. HeLa cells were incubated with unmodified AuNPs (1 nM), nanosensor (1 and 3 nM) for 3, 6, 12, and 24 h. Error bars represent variations between three parallel experiments.
pic

We first treated HeLa cells with 200 μM Pb2+ for 12 h to allow sufficient metal ion uptake. According to a previous study[29], the AuNP-DNAzyme nanoprobe can enter cells through receptor-mediated endocytosis without the use of transfection agents. As shown in Fig. 6a, a red fluorescence signal corresponding to Pb2+ was observed. As a control, HeLa cells without treated with Pb2+ were also incubated with the nanoprobes and imaged under the same conditions and nearly no fluorescence signal was observed (Fig. 6b). To further confirm that the fluorescence observed in Fig. 6a was because of the activity of DNAzyme, an inactive Protmin nanosensor was prepared by using "Inactive 17S", in which the adenosine ribonucleotide at the cleavage site was replaced with a deoxyribonucleotide. As shown in Fig. 6c and 6d, the inactive probe-treated HeLa cells showed less fluorescence than those with the active probe. Staining of lysosomes of cells (green) showed good colocalization of Lysotracker and Protmin nanoprobes, indicating that the nanoprobes were mainly transported to the lysosomes. These results are consistent with those for other nanoprobes constructed based on DNA-AuNPs[29,30]. The results demonstrated the successful implementation of intracellular detection of Pb2+ by using this Protmin nanoprobe.

Fig. 6.
(Color online) (a, b) Confocal microscopy images of HeLa cells treated (a) with or (b) without Pb2+ with active Protmin nanosensor. (c, d) Confocal microscopy images of HeLa cells treated (a) with or (b) without Pb2+ with inactive Protmin nanosensor. The red channel is Cy3 fluorescence and green channel is Lysotracker Green fluorescence. The scale bar is 25 μm.
pic

Ⅳ. CONCLUSION

In summary, we developed a novel intracellular nanosensor based on high-efficient polyA-tailed Protmin with fast kinetics for Pb2+ detection in HeLa cells. Protmin not only possesses enzyme-like catalysis activity, but also has advantages of nanomaterials, such as excellent chemical stability and unique chemistry and it is easy to transduce across cell membranes. Additionally, the polyA tail added to Protmin decreased non-specific adsorption between DNA and gold, thus enhancing the activity of DNAzyme at the nano-interface. PolyA contains natural nucleotides that are easy to synthesize and modify, and thus reduces synthesis costs. Fast kinetics of the Protmin nanosensor were observed and the detection time in vitro was decreased to 10 min, indicating that this system can be used for a rapid detection. In combination with DNAzyme specific for other metal ions, the polyA-tailed Protmin nanoprobes are a simple and general platform for developing high-efficient intracellular nanosensors. The Protmin design is promising for constructing nanostructures mimicking protein functions, which may have wide applications in biomedicine and life sciences.

REFERENCES
1. A.M. Pyle,

Metal ions in the structure and function of RNA

. J. Biol. Inorg. Chem. 7, 679-690 (2002). doi: 10.1007/s00775-002-0387-6
Baidu ScholarGoogle Scholar
2. C.A. Blindauer, O.I. Leszczyszyn,

Metallothioneins: unparalleled diversity in structures and functions for metal ion homeostasis and more

. Nat. Prod. Rep. 27, 720-741 (2010). doi: 10.1039/b906685n
Baidu ScholarGoogle Scholar
3. A. Rolfs, M.A. Hediger,

Metal ion transporters in mammals: structure, function and pathological implications

. J. Physiol. -London 518, 1-12 (1999). doi: 10.1111/j.1469-7793.1999.0001r.x
Baidu ScholarGoogle Scholar
4. P.G. Georgopoulos, A. Roy, M.J. Yonone-Lioy, et al.,

Environmental copper: Its dynamics and human exposure issues

. J. Toxicol. Env. Heal.-B. 4, 341-394 (2001). doi: 10.1080/109374001753146207
Baidu ScholarGoogle Scholar
5. A.T. Jan, M. Azam, K. Siddiqui, et al.,

Heavy Metals and Human Health: Mechanistic Insight into Toxicity and Counter Defense System of Antioxidants

. Int. J. Mol. Sci. 16, 29592-29630 (2015). doi: 10.3390/ijms161226183
Baidu ScholarGoogle Scholar
6. S.C. Izah, N. Chakrabarty, A.L. Srivastav,

A review on heavy metal concentration in potable water sources in Nigeria: Human health effects and mitigating measures

. Expos. Health 8, 285-304 (2016). doi: 10.1007/s12403-016-0195-9
Baidu ScholarGoogle Scholar
7. G. Liang, Y. Man, A. Li, et al.,

DNAzyme-based biosensor for detection of lead ion: A review

. Microchem. J. 131, 145-153 (2017). doi: 10.1016/j.microc.2016.12.010
Baidu ScholarGoogle Scholar
8. D. Li, S. Song, C. Fan,

Target-Responsive Structural Switching for Nucleic Acid-Based Sensors

. Acc. Chem. Res. 43, 631-641 (2010). doi: 10.1021/ar900245u
Baidu ScholarGoogle Scholar
9. X. Qu, F. Yang, H. Chen, et al.,

Bubble-mediated ultrasensitive multiplex detection of metal ions in three-dimensional DNA nanostructure-encoded microchannels

. ACS Appl. Mater. Inter. 9, 16026-16034 (2017). doi: 10.1021/acsami.7b03645f
Baidu ScholarGoogle Scholar
10. S. He, D. Li, C. Zhu, et al.,

Design of a gold nanoprobe for rapid and portable mercury detection with the naked eye

. Chem. Commun. 4885-4887 (2008). doi: 10.1039/b811528a
Baidu ScholarGoogle Scholar
11. L. Li, Y. Wen, L. Xu, et al.,

Development of mercury (II) ion biosensors based on mercury-specific oligonucleotide probes

. Biosens. Bioelectron. 75, 433-445 (2016). doi: 10.1016/j.bios.2015.09.003
Baidu ScholarGoogle Scholar
12. J. Wu, L. Li, D. Zhu, et al.,

Colorimetric assay for mercury (II) based on mercury-specific deoxyribonucleic acid-functionalized gold nanoparticles

. Anal. Chim. Acta. 694, 115-119 (2011). doi: 10.1016/j.aca.2011.02.045
Baidu ScholarGoogle Scholar
13. S.B. Fonseca, M.P. Pereira, S.O. Kelley,

Recent advances in the use of cell-penetrating peptides for medical and biological applications

. Adv. Drug Deliver. Rev. 61, 953-964 (2009). doi: 10.1016/j.addr.2009.06.001
Baidu ScholarGoogle Scholar
14. M.C. Daniel, D. Astruc,

Gold nanoparticles: Assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis, and nanotechnology

. Chem. Rev. 104, 293-346 (2004). doi: 10.1021/cr030698+
Baidu ScholarGoogle Scholar
15. K. Saha, S.S. Agasti, C. Kim, et al.,

Gold nanoparticles in chemical and biological sensing

. Chem. Rev. 112, 2739-2779 (2012). doi: 10.1021/cr2001178
Baidu ScholarGoogle Scholar
16. S. Su, X. Zuo, D. Pan, et al.,

Design and applications of gold nanoparticle conjugates by exploiting biomolecule-gold nanoparticle interactions

. Nanoscale 5, 2589-2599 (2013). doi: 10.1039/c3nr33870c
Baidu ScholarGoogle Scholar
17. P. Chen, D. Pan, C. Fan, et al.,

Gold nanoparticles for high-throughput genotyping of long-range haplotypes

. Nat. Nano., 6, 639-644 (2011). doi: 10.1038/nnano.2011.141
Baidu ScholarGoogle Scholar
18. A.N. Yakunin, Y.A. Avetisyan, V.V. Tuchin,

Quantification of laser local hyperthermia induced by gold plasmonic nanoparticles

. J. Biomed. Opt. 20 (2015). doi: 10.1117/1.jbo.20.5.051030
Baidu ScholarGoogle Scholar
19. S. Wang, S. Deng, X. Cai, et al.,

Superresolution imaging of telomeres with continuous wave stimulated emission depletion (STED) microscope

. Sci. China Chem. 59, 1519-1524 (2016). doi: 10.1007/s11426-016-0020-9
Baidu ScholarGoogle Scholar
20. A. Corma, H. Garcia,

Supported gold nanoparticles as catalysts for organic reactions

. Chem. Soc. Rev. 37, 2096-2126 (2008). doi: 10.1039/b707314n
Baidu ScholarGoogle Scholar
21. X. Zheng, Q. Liu, C. Jing, et al.,

Catalytic gold nanoparticles for nanoplasmonic detection of DNA hybridization

. Angew. Chem. Inter. Ed. 50, 11994-11998 (2011). doi: 10.1002/anie.201105121
Baidu ScholarGoogle Scholar
22. K. Li, K. Wang, W. Qin, et al.,

DNA-directed assembly of gold nanohalo for quantitative plasmonic imaging of single-particle catalysis

. J. Am. Chem. Soc. 137, 4292-4295 (2015). doi: 10.1021/jacs.5b00324
Baidu ScholarGoogle Scholar
23. E. Boisselier, D. Astruc,

Gold nanoparticles in nanomedicine: preparations, imaging, diagnostics, therapies and toxicity

. Chem. Soc. Rev. 38, 1759-1782 (2009). doi: 10.1039/b806051g
Baidu ScholarGoogle Scholar
24. E.C. Dreaden, A.M. Alkilany, X. Huang, et al.,

The golden age: gold nanoparticles for biomedicine

. Chem. Soc. Rev. 41, 2740-2779 (2012). doi: 10.1039/c1cs15237h
Baidu ScholarGoogle Scholar
25. P. Ghosh, G. Han, M. De, et al.,

Gold nanoparticles in delivery applications

. Adv. Drug Deliver. Rev. 60, 1307-1315 (2008). doi: 10.1016/j.addr.2008.03.016
Baidu ScholarGoogle Scholar
26. N.L. Rosi, D.A. Giljohann, C.S. Thaxton, et al.,

Oligonucleotide-modified gold nanoparticles for intracellular gene regulation

. Science 312, 1027-1030 (2006). doi: 10.1126/science.1125559
Baidu ScholarGoogle Scholar
27. L. Lermer, Y. Roupioz, R. Ting, et al.,

Toward an RNaseA mimic: a DNAzyme with imidazoles and cationic amines

. J. Am. Chem. Soc. 124, 9960-9961 (2002). doi: 10.1021/ja0205075
Baidu ScholarGoogle Scholar
28. Y.F. Li, D. Sen,

Toward an efficient DNAzyme

. Biochemistry 36, 5589-5599 (1997). doi: 10.1021/bi962694n
Baidu ScholarGoogle Scholar
29. P. Wu, K. Hwang, T. Lan, et al.,

A DNAzyme-gold nanoparticle probe for uranyl ion in living cells

. J. Am. Chem. Soc. 135, 5254-5257 (2013). doi: 10.1021/ja400150v
Baidu ScholarGoogle Scholar
30. L. Li, J. Feng, Y. Fan, et al.,

Simultaneous imaging of Zn2+ and Cu2+ in living cells based on DNAzyme modified gold nanoparticle

. Anal. Chem. 87, 4829-4835 (2015). doi: 10.1021/acs.analchem.5b00204
Baidu ScholarGoogle Scholar
31. K. Yehl, J.R. Joshi, B.L. Greene, et al.,

Catalytic deoxyribozyme-modified nanoparticles for RNAi-independent gene regulation

. ACS Nano 6, 9150-9157 (2012). doi: 10.1021/nn3034265
Baidu ScholarGoogle Scholar
32. H. Pei, F. Li, Y. Wan, et al.,

Designed diblock oligonucleotide for the synthesis of spatially isolated and highly hybridizable functionalization of DNA-gold nanoparticle nanoconjugates

. J. Am. Chem. Soc. 134, 11876-11879 (2012). doi: 10.1021/ja304118z
Baidu ScholarGoogle Scholar
33. D. Zhu, H. Pei, J. Chao, et al.,

Poly-adenine-based programmable engineering of gold nanoparticles for highly regulated spherical DNAzymes

. Nanoscale 7, 18671-18676 (2015). doi: 10.1039/c5nr05366h
Baidu ScholarGoogle Scholar
34. G. Yao, H. Pei, J. Li, et al.,

Clicking DNA to gold nanoparticles: poly-adenine-mediated formation of monovalent DNA-gold nanoparticle conjugates with nearly quantitative yield

. NPG Asia Mater. 7 (2015). doi: 10.1038/am.2014.131
Baidu ScholarGoogle Scholar
35. D. Zhu, J. Chao, H. Pei, et al.,

Coordination-mediated programmable sssembly of unmodified oligonucleotides on plasmonic silver nanoparticles

. ACS Appl. Mater. Inter. 7, 11047-11052 (2015). doi: 10.1021/acsami.5b03066
Baidu ScholarGoogle Scholar
36. D. Zhu, P. Song, J. Shen, et al.,

PolyA-mediated DNA assembly on gold nanoparticles for thermodynamically favorable and rapid hybridization analysis

. Anal. Chem. 88, 4949-4954 (2016). doi: 10.1021/acs.analchem.6b00891
Baidu ScholarGoogle Scholar
37. K.C. Grabar, R.G. Freeman, M.B. Hommer, et al.,

Preparation and characterization of Au colloid monolayers

. Anal. Chem. 67, 735-743 (1995). doi: 10.1021/ac00100a008
Baidu ScholarGoogle Scholar
38. B. Dubertret, M. Calame, A.J. Libchaber,

Single-mismatch detection using gold-quenched fluorescent oligonucleotides

. Nat. Biotechnol. 19, 365-370 (2001). doi: 10.1038/86762
Baidu ScholarGoogle Scholar
39. H. Tang, N. Zhang, Z. Chen, et al.,

Probing hydroxyl radicals and their imaging in living cells by use of FAM-DNA-Au nanoparticles

. Chem. -Eur. J. 14, 522-528 (2008). doi: 10.1002/chem.200700455
Baidu ScholarGoogle Scholar
40. S.J. Hurst, A.K.R. Lytton-Jean, C.A. Mirkin,

Maximizing DNA loading on a range of gold nanoparticle sizes

. Anal. Chem. 78, 8313-8318 (2006). doi: 10.1021/ac0613582
Baidu ScholarGoogle Scholar
41. Z.B. Wen, W.B. Liang, Y. Zhuo, et al.,

An efficient target-intermediate recycling amplification strategy for ultrasensitive fluorescence assay of intracellular lead ions

. Chem. Commun. 53, 7525-7528 (2017). doi: 10.1039/c7cc04104g
Baidu ScholarGoogle Scholar
42. W. Zhou, W. Liang, D. Li, et al.,

Dual-color encoded DNAzyme nanostructures for multiplexed detection of intracellular metal ions in living cells

. Biosens. Bioelectron. 85, 573-579 (2016). doi: 10.1016/j.bios.2016.05.058
Baidu ScholarGoogle Scholar
43. C. Xiong, W. Liang, H. Wang, et al.,

In situ electro-polymerization of nitrogen doped carbon dots and their application in an electrochemiluminescence biosensor for the detection of intracellular lead ions

. Chem. Commun. 52, 5589-5592 (2016). doi: 10.1039/c6cc01078d
Baidu ScholarGoogle Scholar